Text Search Class Browser Quick Queries Query Language Query by Example Batch Query AQL Query Table Maker BLAST GrainGenes 2.0

Text Display

Webace View

Probe : WMS533

[Submit comment/correction]

Locus[Show (10)]
Reference A microsatellite map of wheat
General_remark Insert contains repeat (CT)18(CA)20                                                                                  
               PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY.                                                               
                 REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.                                                         
Type PCR 
     SSR   
PCR_primers 5' AAGGCGAATCAAACGGAATA 3' 
            5' GTTGCTTTAGGGGAAAAGCC 3'   
Amplification_conditions 3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min                                                                                      
                           at 60 deg C, and 2 min at 72 deg C; and a final extension                                                                                     
                           step of 10 min at 72 deg C                                                                                                                    
Polymorphism WMS533
Origin Source_species Triticum aestivum
       Source_germplasm Chinese Spring 
Data_source Roeder, Marion S. 98.09.15

GrainGenes Home Page
AcePerl Home Page
AceBrowser Enhancements
Contact the GrainGenes Curators