Text Display

Webace View

Probe : BARC77

[Submit comment/correction]

Locus Xbarc77-3B
General_remark Contains motif : (ATCT)6+18                                                                                                                                                                                                                                                                                                                                                                                                                                  
               BARC primer pairs are developed by P. Cregan, Q. Song and                                                                                                                                                                                                                                                                                                                                                                                                    
                 associates at the USDA-ARS Beltsville Agriculture Research                                                                                                                                                                                                                                                                                                                                                                                                 
                 Station. Meiotic map information was developed by J.R. Shi,                                                                                                                                                                                                                                                                                                                                                                                                
                 R. Ward and associates at Michigan State University.                                                                                                                                                                                                                                                                                                                                                                                                       
                 Deletion map information was developed by B.Gill, S. Singh                                                                                                                                                                                                                                                                                                                                                                                                 
                 and associates at Kansas State University. Funding for this                                                                                                                                                                                                                                                                                                                                                                                                
                 research is provided by USDA-ARS in conjunction with the                                                                                                                                                                                                                                                                                                                                                                                                   
                 U.S. Wheat and Barley Scab Initiative.                                                                                                                                                                                                                                                                                                                                                                                                                       
Type PCR 
     SSR   
PCR_primers 5'  GCGTATTCTCCCTCGTTTCCAAGTCTG  3' 
            5'  GTGGGAATTTCTTGGGAGTCTGTA  3'      
Amplification_conditions Annealing temperature = 55 
Sequence BV211797
Origin Source_species Triticum aestivum
Data_source Ward, Rick

GrainGenes Home Page AcePerl Home Page

AceBrowser Enhancements Contact the GrainGenes Curators